pradyumnasagar-open-research-skills

codon-usage

Compute codon usage frequencies, RSCU, CAI, and tRNA adaptation — for gene expression prediction, heterologous expression design, and comparative genomics.
星标7
复刻2
关注7
更新时间2026-09-03 16:08:57

Codon Usage and Bias

Hard rules

  1. No fabricated citations. Every cited work must resolve to a verifiable
  2. No claim without provenance. Every quantitative or factual claim
  3. No silent failure. Every script invocation, API call, or tool use must declare its exit status and what to do on non-zero. A skill that silently swallows errors is a violation.

When to use

  • Predicting heterologous expression yield (high CAI in the host → likely high expression).
  • Comparing codon bias across organisms.
  • Designing codon-optimized coding sequences.
  • Building a reference codon-usage table from a genome.

When NOT to use

  • Gene finding (use pyrodigal / bakta).
  • Variant effect on protein (use SIFT / PolyPhen / AlphaMissense).

Prerequisites

  • biopython>=1.83
  • For codon optimization: dnachisel (open source) or GeneDesign (open source)

Core workflow

  1. Pick the right metric: RSCU for bias direction, CAI for expression prediction, ENC for strength of bias.
  2. Build or load a reference codon table (from a host genome or a published table).
  3. Compute the metric for your gene.
  4. If optimizing, generate a sequence that maximizes the metric while preserving amino acid sequence and avoiding restriction sites / RNA structures.

Code patterns

Build a codon usage table from a genome's CDS

from Bio import SeqIO
from collections import Counter
from Bio.Seq import Seq

def codon_counter(cds_iter, table=1):"
    """Yield codon counts from an iterator of CDS sequences."""
    c = Counter()
    for s in cds_iter:
        s = Seq(str(s).upper())
        if len(s) % 3 != 0:
            s = s[:len(s) - len(s) % 3]
        for i in range(0, len(s), 3):
            c[str(s[i:i+3])] += 1
    return c

Relative Synonymous Codon Usage (RSCU)

RSCU = (observed count of codon) / (expected count if all synonymous codons were equal).

from Bio.Data import CodonTable
from collections import defaultdict

def rscu(counts: dict, table_id: int = 1) -> dict:
    t = CodonTable.unambiguous_dna_by_id[table_id]
    aa_to = defaultdict(list)
    for codon, aa in t.forward_table.items():
        aa_to[aa].append(codon)
    out = {}
    for aa, codons in aa_to.items():
        n_syn = len(codons)
        total = sum(counts.get(c, 0) for c in codons)
        if total == 0:
            for c in codons:
                out[c] = 0.0
            continue
        expected = total / n_syn
        for c in codons:
            out[c] = counts.get(c, 0) / expected if expected else 0.0
    return out

RSCU > 1 means the codon is used more often than expected; < 1 means less.

Codon Adaptation Index (CAI)

CAI = geometric mean of relative adaptiveness (weight of each codon = RSCU / max RSCU for that amino acid in the reference set).

import math

def cai(seq: str, ref_counts: dict, table_id: int = 1) -> float:
    t = CodonTable.unambiguous_dna_by_id[table_id]
    aa_to = defaultdict(list)
    for codon, aa in t.forward_table.items():
        aa_to[aa].append(codon)
    max_w = {}
    for aa, codons in aa_to.items():
        total = sum(ref_counts.get(c, 0) for c in codons)
        if total == 0:
            for c in codons:
                max_w[c] = 0.0
            continue
        weights = {c: ref_counts.get(c, 0) / (total / len(codons)) for c in codons}
        m = max(weights.values()) or 1.0
        for c, w in weights.items():
            max_w[c] = w / m
    s = Seq(seq.upper())
    if len(s) % 3 != 0:
        s = s[:len(s) - len(s) % 3]
    log_sum = 0.0
    n = 0
    for i in range(0, len(s), 3):
        c = str(s[i:i+3])
        w = max_w.get(c, 0.0)
        if w > 0:
            log_sum += math.log(w)
            n += 1
    return math.exp(log_sum / n) if n else 0.0

CAI ranges 0-1. Higher = more "host-like" codons. > 0.8 is considered highly expressed in the host.

Effective Number of Codons (ENc)

ENc ranges 20 (extreme bias, one codon per amino acid) to 61 (no bias). Wright 1990 formula:

def enc(counts: dict, table_id: int = 1) -> float:
    from Bio.Data import CodonTable
    t = CodonTable.unambiguous_dna_by_id[table_id]
    aa_to = defaultdict(list)
    for codon, aa in t.forward_table.items():
        aa_to[aa].append(codon)

    f_vals = []
    for aa, codons in aa_to.items():
        n = len(codons)
        if n == 1:
            continue
        total = sum(counts.get(c, 0) for c in codons)
        if total <= 1:
            continue
        # homozygosity F = (n * sum(p_i^2) - 1) / (n - 1)
        p = [counts.get(c, 0) / total for c in codons]
        f = (n * sum(pi * pi for pi in p) - 1) / (n - 1)
        f_vals.append(f)

    # Wright's formula
    enc = 2 + 9 / (sum(f_vals) / len(f_vals)) if f_vals else 0
    return enc

Use a published reference table (E. coli K-12)

# Kazusa codon usage database provides these as text
# https://www.kazusa.or.jp/codon/
ECOLI_CODONS = {
    "ATG": 1000,   # example, replace with real counts
    "TTT":  500,
    # ... full table from Kazusa
}

For real work, parse the Kazusa .txt file or use python_codon_tables (PyPI).

Codon optimization with DNA Chisel (open source)

import dnachisel as dc

problem = dc.DnaOptimizationProblem(
    sequence="ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG",
    constraints=[
        dc.EnforceTranslation(),
        dc.EnforceGCContent(mini=0.4, maxi=0.6, window=50),
        dc.AvoidPattern("BsaI_site"),  # avoid restriction sites
    ],
    objectives=[dc.CodonOptimize(species="e_coli")],
)
problem.resolve()
print(problem.sequence)  # optimized sequence

Codon harmonization (preserve original codon bias, not maximize)

For cross-species expression where the source organism's translation speed pattern matters, "harmonize" the sequence to use the destination's most-frequent codon for each amino acid in a way that mimics the source's translational pauses.

Tools: codon harmonization Python package; CHARMING web server (academic).

Common pitfalls

  • Computing CAI on the wrong frame. A multiple-of-3 length is the only frame that produces a real CAI.
  • RSCU of 0 for a synonymous codon that wasn't observed. RSCU = 0 means the codon is absent in the reference; not the same as "disallowed".
  • CAI close to 1 doesn't guarantee expression. It predicts codon availability for the tRNA pool, not mRNA stability, protein folding, or toxicity.
  • Optimizing for codon bias destroys mRNA structure and may introduce rare restriction sites. Always combine with EnforceGCContent, AvoidPattern, and structure objectives.
  • Cross-species CAI comparisons are invalid. CAI is relative to a reference. Pick the host's reference, not the donor's.

Validation

  • CAI is in [0, 1].
  • RSCU values for synonymous codons sum to the number of synonymous codons per amino acid.
  • ENc is in [20, 61].
  • A codon-optimized sequence still translates to the same amino acid sequence (use translate(to_stop=True) to verify).

Open alternatives

NeedTool
Codon optimizationDNA Chisel, GeneDesign
CAI/RSCU/ENc reference tablespython_codon_tables (PyPI), Kazusa
Codon harmonizationcodon-harmonization (PyPI), CHARMING
Expression prediction (ML)CodonBERT, mRFP

References

Changelog

  • 1.0.0 (2026-06-10): Initial adaptation by Pradyumna Jayaram from bio-codon-usage (bioSkills-main/sequence-manipulation/codon-usage).

Cross-references

Other skills in this category:

  • batch-processing
  • bowtie2-alignment
  • bwa-alignment
  • bwa-mem2-alignment
  • compressed-sequence-files
  • fastq-quality-scores
  • filter-sequences
  • format-conversion
  • hisat2-alignment
  • motif-search
  • paired-end-fastq
  • pysam-genomics
  • read-write-sequences
  • reverse-complement
  • sam-bam-basics
  • samtools-bam-processing
  • seq-objects
  • sequence-properties
  • sequence-slicing
  • sequence-statistics
  • star-alignment
  • transcription-translation

继续浏览同一来源仓库中的其他 Skills。