codon-usage
Compute codon usage frequencies, RSCU, CAI, and tRNA adaptation — for gene expression prediction, heterologous expression design, and comparative genomics.Codon Usage and Bias
Hard rules
- No fabricated citations. Every cited work must resolve to a verifiable
- No claim without provenance. Every quantitative or factual claim
- No silent failure. Every script invocation, API call, or tool use must declare its exit status and what to do on non-zero. A skill that silently swallows errors is a violation.
When to use
- Predicting heterologous expression yield (high CAI in the host → likely high expression).
- Comparing codon bias across organisms.
- Designing codon-optimized coding sequences.
- Building a reference codon-usage table from a genome.
When NOT to use
- Gene finding (use pyrodigal / bakta).
- Variant effect on protein (use SIFT / PolyPhen / AlphaMissense).
Prerequisites
biopython>=1.83- For codon optimization:
dnachisel(open source) orGeneDesign(open source)
Core workflow
- Pick the right metric: RSCU for bias direction, CAI for expression prediction, ENC for strength of bias.
- Build or load a reference codon table (from a host genome or a published table).
- Compute the metric for your gene.
- If optimizing, generate a sequence that maximizes the metric while preserving amino acid sequence and avoiding restriction sites / RNA structures.
Code patterns
Build a codon usage table from a genome's CDS
from Bio import SeqIO
from collections import Counter
from Bio.Seq import Seq
def codon_counter(cds_iter, table=1):"
"""Yield codon counts from an iterator of CDS sequences."""
c = Counter()
for s in cds_iter:
s = Seq(str(s).upper())
if len(s) % 3 != 0:
s = s[:len(s) - len(s) % 3]
for i in range(0, len(s), 3):
c[str(s[i:i+3])] += 1
return c
Relative Synonymous Codon Usage (RSCU)
RSCU = (observed count of codon) / (expected count if all synonymous codons were equal).
from Bio.Data import CodonTable
from collections import defaultdict
def rscu(counts: dict, table_id: int = 1) -> dict:
t = CodonTable.unambiguous_dna_by_id[table_id]
aa_to = defaultdict(list)
for codon, aa in t.forward_table.items():
aa_to[aa].append(codon)
out = {}
for aa, codons in aa_to.items():
n_syn = len(codons)
total = sum(counts.get(c, 0) for c in codons)
if total == 0:
for c in codons:
out[c] = 0.0
continue
expected = total / n_syn
for c in codons:
out[c] = counts.get(c, 0) / expected if expected else 0.0
return out
RSCU > 1 means the codon is used more often than expected; < 1 means less.
Codon Adaptation Index (CAI)
CAI = geometric mean of relative adaptiveness (weight of each codon = RSCU / max RSCU for that amino acid in the reference set).
import math
def cai(seq: str, ref_counts: dict, table_id: int = 1) -> float:
t = CodonTable.unambiguous_dna_by_id[table_id]
aa_to = defaultdict(list)
for codon, aa in t.forward_table.items():
aa_to[aa].append(codon)
max_w = {}
for aa, codons in aa_to.items():
total = sum(ref_counts.get(c, 0) for c in codons)
if total == 0:
for c in codons:
max_w[c] = 0.0
continue
weights = {c: ref_counts.get(c, 0) / (total / len(codons)) for c in codons}
m = max(weights.values()) or 1.0
for c, w in weights.items():
max_w[c] = w / m
s = Seq(seq.upper())
if len(s) % 3 != 0:
s = s[:len(s) - len(s) % 3]
log_sum = 0.0
n = 0
for i in range(0, len(s), 3):
c = str(s[i:i+3])
w = max_w.get(c, 0.0)
if w > 0:
log_sum += math.log(w)
n += 1
return math.exp(log_sum / n) if n else 0.0
CAI ranges 0-1. Higher = more "host-like" codons. > 0.8 is considered highly expressed in the host.
Effective Number of Codons (ENc)
ENc ranges 20 (extreme bias, one codon per amino acid) to 61 (no bias). Wright 1990 formula:
def enc(counts: dict, table_id: int = 1) -> float:
from Bio.Data import CodonTable
t = CodonTable.unambiguous_dna_by_id[table_id]
aa_to = defaultdict(list)
for codon, aa in t.forward_table.items():
aa_to[aa].append(codon)
f_vals = []
for aa, codons in aa_to.items():
n = len(codons)
if n == 1:
continue
total = sum(counts.get(c, 0) for c in codons)
if total <= 1:
continue
# homozygosity F = (n * sum(p_i^2) - 1) / (n - 1)
p = [counts.get(c, 0) / total for c in codons]
f = (n * sum(pi * pi for pi in p) - 1) / (n - 1)
f_vals.append(f)
# Wright's formula
enc = 2 + 9 / (sum(f_vals) / len(f_vals)) if f_vals else 0
return enc
Use a published reference table (E. coli K-12)
# Kazusa codon usage database provides these as text
# https://www.kazusa.or.jp/codon/
ECOLI_CODONS = {
"ATG": 1000, # example, replace with real counts
"TTT": 500,
# ... full table from Kazusa
}
For real work, parse the Kazusa .txt file or use python_codon_tables (PyPI).
Codon optimization with DNA Chisel (open source)
import dnachisel as dc
problem = dc.DnaOptimizationProblem(
sequence="ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG",
constraints=[
dc.EnforceTranslation(),
dc.EnforceGCContent(mini=0.4, maxi=0.6, window=50),
dc.AvoidPattern("BsaI_site"), # avoid restriction sites
],
objectives=[dc.CodonOptimize(species="e_coli")],
)
problem.resolve()
print(problem.sequence) # optimized sequence
Codon harmonization (preserve original codon bias, not maximize)
For cross-species expression where the source organism's translation speed pattern matters, "harmonize" the sequence to use the destination's most-frequent codon for each amino acid in a way that mimics the source's translational pauses.
Tools: codon harmonization Python package; CHARMING web server (academic).
Common pitfalls
- Computing CAI on the wrong frame. A multiple-of-3 length is the only frame that produces a real CAI.
- RSCU of 0 for a synonymous codon that wasn't observed. RSCU = 0 means the codon is absent in the reference; not the same as "disallowed".
- CAI close to 1 doesn't guarantee expression. It predicts codon availability for the tRNA pool, not mRNA stability, protein folding, or toxicity.
- Optimizing for codon bias destroys mRNA structure and may introduce rare restriction sites. Always combine with
EnforceGCContent,AvoidPattern, and structure objectives. - Cross-species CAI comparisons are invalid. CAI is relative to a reference. Pick the host's reference, not the donor's.
Validation
- CAI is in [0, 1].
- RSCU values for synonymous codons sum to the number of synonymous codons per amino acid.
- ENc is in [20, 61].
- A codon-optimized sequence still translates to the same amino acid sequence (use
translate(to_stop=True)to verify).
Open alternatives
| Need | Tool |
|---|---|
| Codon optimization | DNA Chisel, GeneDesign |
| CAI/RSCU/ENc reference tables | python_codon_tables (PyPI), Kazusa |
| Codon harmonization | codon-harmonization (PyPI), CHARMING |
| Expression prediction (ML) | CodonBERT, mRFP |
References
- Sharp & Li 1987 (CAI): https://doi.org/10.1093/nar/15.3.1281
- Wright 1990 (ENc): https://doi.org/10.1093/nar/18.1.171
- Kazusa codon DB: https://www.kazusa.or.jp/codon/
- DNA Chisel: https://github.com/Edinburgh-Genome-Foundry/DnaChisel
- Companion:
ors-bioinformatics-sequence-transcription-translation,ors-bioinformatics-sequence-sequence-properties.
Changelog
- 1.0.0 (2026-06-10): Initial adaptation by Pradyumna Jayaram from
bio-codon-usage(bioSkills-main/sequence-manipulation/codon-usage).
Cross-references
Other skills in this category:
- batch-processing
- bowtie2-alignment
- bwa-alignment
- bwa-mem2-alignment
- compressed-sequence-files
- fastq-quality-scores
- filter-sequences
- format-conversion
- hisat2-alignment
- motif-search
- paired-end-fastq
- pysam-genomics
- read-write-sequences
- reverse-complement
- sam-bam-basics
- samtools-bam-processing
- seq-objects
- sequence-properties
- sequence-slicing
- sequence-statistics
- star-alignment
- transcription-translation
相关 Skills
继续浏览同一来源仓库中的其他 Skills。