Transcription and Translation

"

Transcribe is "T → U". Translate is "3 bases → 1 amino acid". The whole problem is picking the right codon table — there are 27 NCBI genetic codes, and picking the wrong one for a mitochondrial gene silently produces a wrong protein. This skill is the canonical patterns, the cds=True strictness check, and the codon-table index.

When to use

• mRNA from a coding sequence.
• Protein sequence from a CDS (or whole genome, for prokaryotes).
• Reverse transcription (mRNA → cDNA, U → T).
• Verifying that a predicted ORF really is a CDS (no internal stops, correct frame).

When NOT to use

• Gene finding (de novo ORF detection) → use pyrodigal, prodigal, or MetaGeneAnnotator.
• Genome annotation → use bakta or prokka.
• For translation with frameshifts / selenocysteine → custom logic with NCBITSite.

Prerequisites

• biopython>=1.83

Core workflow

1. Pick the codon table — NCBI table 1 is the standard genetic code.
2. Get the CDS — either a feature from GenBank, or your own extracted ORF.
3. Translate with cds=True if you want validation; cds=False for "translate whatever".
4. Verify — length divisible by 3, no internal stops (or stops are expected for selenocysteine / pyrrolysine).

NCBI codon tables (most common, 2026)

Full list: https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi

Code patterns

Basic transcription and translation

from Bio.Seq import Seq

coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
mrna = coding_dna.transcribe()              # T → U
protein = coding_dna.translate()            # MAIVMGR*

Strict CDS validation (cds=True)

protein = coding_dna.translate(cds=True)

This raises Bio.Data.CodonTable.TranslationError if:

• Length is not a multiple of 3.
• The CDS doesn't start with ATG.
• The CDS doesn't end with a stop codon (TAA, TAG, TGA).

For mitochondrial code (table 2), stop codons are different (AGA, AGG, TAA, etc.):

protein = coding_dna.translate(table=2, cds=True)

Reverse transcription (mRNA → cDNA)

mrna = Seq("AUGGCCAUUGUAA")
cdna = mrna.back_transcribe()    # U → T

Translate a non-standard genetic code

# Vertebrate mitochondrial
protein = coding_dna.translate(table=2)

# Yeast mitochondrial
protein = coding_dna.translate(table=3)

Translate to stop (drop the trailing stop)

protein = coding_dna.translate(to_stop=True)  # MAIVMGR

Translate with full table object

from Bio.Data import CodonTable

std = CodonTable.unambiguous_dna_by_id[1]      # standard
mt = CodonTable.unambiguous_dna_by_id[2]       # vertebrate mt

print(std.stop_codons)   # ['TAA', 'TAG', 'TGA']
print(mt.stop_codons)    # ['TAA', 'TAG', 'AGA', 'AGG']
print(std.start_codons)  # ['TTG', 'CTG', 'ATG'] (alt starts in bacteria)

Extract CDS from GenBank and translate

from Bio import SeqIO

rec = next(SeqIO.parse("chr1.gb", "genbank"))
for feat in rec.features:
    if feat.type == "CDS":
        nt = feat.extract(rec.seq)
        protein = nt.translate(cds=True)   # raises if feature is malformed
        print(feat.qualifiers.get("gene", ["?"])[0], protein[:30])

Six-frame translation (for ORF finding)

def six_frames(seq: str, table: int = 1) -> list[str]:
    from Bio.Seq import Seq
    s = Seq(seq)
    rc = s.reverse_complement()
    return [str(s[i:].translate(table=table)) for i in range(3)] + \
           [str(rc[i:].translate(table=table)) for i in range(3)]

Validate a predicted ORF

def validate_cds(seq: str, table: int = 1) -> bool:
    from Bio.Seq import Seq
    s = Seq(seq)
    if len(s) % 3 != 0:
        return False
    if not s.upper().startswith("ATG"):
        return False
    try:
        s.translate(table=table, cds=True)
        return True
    except Exception:
        return False

Common pitfalls

• Translating raw genomic DNA. Eukaryotic genes have introns. Use the CDS feature, not the whole gene.
• Wrong codon table for mitochondria. In vertebrate mtDNA, AGA and AGG are stops, not Arg. In standard code, they code for Arg.
• cds=True is strict. A genuine prokaryotic CDS that uses GTG as a start will fail. Use cds=False if you allow alternative starts.
• Frame confusion. A 900 bp CDS is 300 aa. If you get 297 or 303, your frame is off by 1.
• Forgetting to_stop=True leaves the stop codon as * in the protein. Decide whether you want it.

Validation

• Length of protein ≈ length of CDS / 3.
• First amino acid is M (or fM in mitochondria).
• Last character is * if you didn't use to_stop=True.
• For a real CDS, no internal *.

Open alternatives

References

• Biopython translation: https://biopython.org/docs/latest/api/Bio.Seq.html#Bio.Seq.Seq.translate
• NCBI genetic codes: https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
• Companion: ors-bioinformatics-sequence-codon-usage, ors-bioinformatics-sequence-sequence-properties.

Changelog

• 1.0.0 (2026-06-10): Initial adaptation by Pradyumna Jayaram from bio-transcription-translation (bioSkills-main/sequence-manipulation/transcription-translation).